Plants, unlike humans or animals, cannot move location to get away from danger. Instead, they have developed unique strategies to cope with environmental challenges such as drought or flooding, high and low temperatures, wounding, insect pests, and pathogens. These coping strategies are determined by the composition and sequence of letters (A, C, G and T) that make up each individual’s DNA. Just like the words “stripe,” “priest,” “sprite,” and “ripest,” have the same letters but very different meanings, differences in the order of letters (A, C, G and T) that encode the genetic blueprint result in differences in how the plant looks, grows and produces seeds.
Molecular Markers “Mark” Areas of DNA That Could Help Build Better Plants
Advances in the technologies used for sequencing, or identifying the unique sequence of letters in the DNA of an individual, has reduced the cost and increased the speed of obtaining this information. Sequencing the human genome cost millions of dollars a few years ago; now, it is possible to get a version of the genome sequence for about $1,000. The same technologies used to sequence the human genome are used in plants. These technologies identify specific letters in a plant’s DNA that allow the plant to be either resistant or susceptible to a particular disease. These differences can be detected in thousands of plants using molecular markers, which are similar to sticky notes in that they are used to tag or mark a section of interest — in this case, a particular sequence in the genetic blueprint, that will result in a better plant.
Plants with fewer and deeper roots have different letters at the same position of certain genes associated with root growth compared to plants with more branched roots (Fig. 1). All plants with branched roots have T and A, while plants with a more predominant tap root have a C and a G instead at the same position.
Improving Drought Tolerance in Plants
Initial sequencing technologies focused on evaluating differences in one or a few genes, such as a flower color (purple or yellow) or disease susceptible versus resistant. In this case, sequence differences in only one or a few genes are responsible for the differences in how the plant looks or responds to a pathogen attack. In contrast, more complex characteristics such as drought tolerance or biomass yield are the result of a coordinated network of genes working together, and each of these genes have a small effect. For example, we can help plants cope with drought stress by modifying the amount and composition of wax on the leaves to reduce water loss, increasing the amount of sugars accumulated in the plant to reduce water loss, or developing roots that can grow deeper to access water reserves in the subsoil.
Technologic Advances Making Process More Efficient
Traditionally, the process of identifying the best plants for growing or developing a new variety include planting thousands of seeds in the field then waiting for them to germinate and grow — months, two or three years, or even seven to eight years in the case of pecan trees — before knowing how much biomass or nuts they produce.
Plants with fewer and deeper roots have different letters at the same position of certain genes associated with root growth compared to plants with more branched roots.
Advances in the accessibility and speed of sequencing thousands of genes makes it possible to survey sequence differences in the entire genome compared to targeting a single gene. In this case, young leaves from plants that are about a week old can be used to screen thousands of plants to tag the plants with a specific section of DNA or molecular marker and predict the performance of the plant in the field in days versus months or years.
DNA OF plants with tap roots compared to plants with branched roots
Below is the genetic blueprint of a branched and tap root. T and A indicators are highlighted in the DNA sequence of a branched root.
TCATGCCAAGGTTGAAGTGAAAGACCATGAATGAATGTGTTGCAA
On a tap root the T and A indicators from above are replaced with C and G indicators with sequencing DNA.
TCATGCCAAGGTCGAAGTGAAAGACCATGAGTGGATGTGTTGCAA
Research in One Species Benefits Others
Many of the genes associated with plant growth and development, including seed retention versus seed shattering, are conserved between related species. For example, a seed shatter resistance gene first identified in soybeans is useful to detect differences between hairy vetch plants that retain seeds versus those that drop their seeds. This highlights how research investments in one species can be useful to develop a solution to the seed shattering issue in cover crop legumes.
Combining Beneficial Traits
Another use of these molecular technologies is the ability to combine multiple beneficial traits such as drought tolerance, winter hardiness and disease resistance into a single plant. Further, it allows plant breeders to identify and integrate new resistance genes as new pathogens or insects develop in these biological systems much faster.
On a larger scale, the emergence of “genomic selection” takes into account small differences in performance associated with multiple genes that, when combined, can impact profitability for the year. The improved varieties developed can be identified based on their unique genetic blueprint and provide genetic solutions driven by natural differences between individual plants to address practical challenges that limit agricultural productivity.
